small rna (sirna) target finder software  (GenScript corporation)

Journal:

Article Title: PSD-93 Deficiency Protects Cultured Cortical Neurons from NMDA Receptor-triggered Neurotoxicity

doi: 10.1016/j.neuroscience.2010.01.030

Figure Lengend Snippet: Efficacy of pCMV-U6-siRNA constructs. (A)RT-PCR analysis showed that a 495 bp product from PSD-93 was inhibited significantly by siP3, GAPDH mRNA was used as a loading Control. siP3 significantly decreased the mRNA of PSD93 by 80.2% of control.(B) Confirmation by western blot analysis of silencing PSD93 expression, The blots were reprobed with anti-GAPDH antibody to verify protein loading. (C) Relative protein level of PSD-93 after siRNA transfection, PSD93 decreased by 79.5% compared to control group when transfected with siP3.

Article Snippet: Small RNA (siRNA) Target Finder software (from Genescript Corporation, http://www.genscript.com ) was used to design siRNA and construct small hairpin RNA against PSD93 (shRNA). shRNAs were synthesized and subsequently cloned into pCMV-U6 vector using Bbsl and BglII (Genscript, USA).

Techniques: Construct, Reverse Transcription Polymerase Chain Reaction, Control, Western Blot, Expressing, Transfection

Journal: Diabetes

Article Title: Insulin Granule Recruitment and Exocytosis Is Dependent on p110γ in Insulinoma and Human β-Cells

doi: 10.2337/db08-1371

Figure Lengend Snippet: Expression of p110γ and effect of siRNA knockdown. A : Expression of p110γ was confirmed by Western blot of protein lysates from human islets and INS-1 832/13 cells ( left ). Expression of p110γ, but not the related p110β, was reduced by an adenovirus-delivered si-p110γ construct in INS-1 832/13 cells ( right ). B : The average expression levels of p110γ and p110β in the si-p110γ INS-1 832/13 cells is shown normalized to β-actin and expressed as a percentage of the si-scramble control. C : Capacitance and Ca 2+ current recordings from INS-1 832/13 cells expressing si-scramble (black lines) or si-p110γ (gray lines). D and E : The average capacitance response is shown, normalized to cell size ( D ) and Ca 2+ current charge ( E ). ** P < 0.01.

Article Snippet: A scrambled control sequence (GCTAAATAATCGGATGATGT) was generated using Genscript (Piscataway, NJ) small-interfering RNA (siRNA) target finder software, synthesized as a hairpin oligo with Bam HI and Hind III restriction sites on the 5′ and 3′ ends, respectively, and ligated into the pRNAT-H1.1/shuttle vector (Clontech, Mountain View, CA).

Techniques: Expressing, Knockdown, Western Blot, Construct, Control